View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_85 (Length: 253)
Name: NF20479_low_85
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_85 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 50893792 - 50894030
Alignment:
| Q |
15 |
aatatctgcctatttcactatttcttcttctttctttctgtttcgagaaaacggtaaacaagccacataaattgtgaatgtctactgtgccatcttgagt |
114 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50893792 |
aatatgtgcctatttcacgatttcttcttctttctttctgtttcgagaaaacggtaaacaagccacataaaatgtgaatgtctactgtgccatcttgagc |
50893891 |
T |
|
| Q |
115 |
tgtctcaatatttgaatagcacatttcagaataaccaaccacatttatacaaaaaataatcaatgatgaatatgcacacacatttacaatatccatctta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50893892 |
tgtctcaatatttgaatagcacatttcagaacaaccaacaagatttatacaaaaaataatcaatgacgaatatgcacacacatttacaatatccatctta |
50893991 |
T |
|
| Q |
215 |
ataatctaaaacgataaagtatacaaaatctacaaaatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50893992 |
ataatctaaaacgataaagtatacaaaatctacaaaatt |
50894030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University