View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_92 (Length: 246)
Name: NF20479_low_92
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_92 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 758264 - 758059
Alignment:
| Q |
17 |
agatagatacttaagcatcatataggattgcttattgatgaagtctccactattgctattaccttactatatttatcatctatgcaaatatttaccatgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
758264 |
agatagatacttaagcatcatataggattgcttattgatgaagtctccactattgctattaccttactatattcatcatctatgcaaatatttactatgt |
758165 |
T |
 |
| Q |
117 |
tttcttataatttaaatgaagttaaaaattctatgttgatataagcatgggtaactcttaaaaatgttatcaactattccctccgtattttattataaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
758164 |
tttcttataatttaaatgaagttaaaaattctatgttgatataagcatgggtaacttttaaaaatgttatcaactattccctccgtattttattataaat |
758065 |
T |
 |
| Q |
217 |
catttt |
222 |
Q |
| |
|
||||| |
|
|
| T |
758064 |
aatttt |
758059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University