View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20479_low_95 (Length: 240)

Name: NF20479_low_95
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20479_low_95
NF20479_low_95
[»] chr3 (1 HSPs)
chr3 (1-225)||(32260026-32260250)


Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 32260026 - 32260250
Alignment:
1 tgcactgaaaatggatctactaatgactataagagcagcaaaaagtactagcctacttggaatattacccctcatggcttcttttacggttttatcatta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
32260026 tgcactgaaaatggatctactaatgactataagagcagcaaaaagtactagcctacttggaatattacccctcatggcttctttttcggttttatcatta 32260125  T
101 cttctaaaagttttttatgtaccacacaaccctcatatcaaaatagaagcttcgcgtacagcattaagtgctacgatagcattcagtaatttccctgcag 200  Q
    || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32260126 ctcctgaaagttttttatgtaccacacaaccctcatatcaaaatagaagcttcgcgtacagcattaagtgctacgatagcattcagtaatttccctgcag 32260225  T
201 tgtccgatgctttgatagaacttaa 225  Q
    |||||||||||||||||||||||||    
32260226 tgtccgatgctttgatagaacttaa 32260250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University