View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_96 (Length: 240)
Name: NF20479_low_96
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_96 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 15 - 148
Target Start/End: Complemental strand, 4694657 - 4694524
Alignment:
| Q |
15 |
gattattcttacgatgaagggtgggattttgatcttataccactcaaagtagctacatggggggctttttgtccttctcaacttggaaaaggagaacctt |
114 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4694657 |
gatttttcttaccatgaagggtgggattttgatcttataccactcaaagtagctacatggggggctttttgtccttctcaacttggaaaaggagaacctt |
4694558 |
T |
|
| Q |
115 |
tttcacgaggaggttgatattcataaaaaattta |
148 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
4694557 |
tttcacgaggaggttgataatcataaaaaattta |
4694524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 110
Target Start/End: Original strand, 52736299 - 52736387
Alignment:
| Q |
21 |
tcttacgatgaagggtgggattttgatcttataccactcaaagtagctacatggggggctttttgtccttctcaacttggaaaaggagaa |
110 |
Q |
| |
|
|||||| ||||||||| |||||||| |||||||||| |||||||||| || |||||| ||||| ||||||||||| || | ||||||||| |
|
|
| T |
52736299 |
tcttaccatgaagggtaggattttggtcttataccaatcaaagtagcgacctgggggcctttt-gtccttctcaattttggaaaggagaa |
52736387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University