View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_99 (Length: 238)
Name: NF20479_low_99
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_99 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 149 - 209
Target Start/End: Complemental strand, 6629430 - 6629370
Alignment:
| Q |
149 |
cattttggtaataatgtacattaattagcattgagacgggaattcgtgcccgtctatatcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6629430 |
cattttggtaataatgtacattaattagcattgagacgggaattcgtgcccgtctatatcc |
6629370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 53
Target Start/End: Complemental strand, 6629560 - 6629525
Alignment:
| Q |
18 |
ttttaaacgaatttcttcaattttctactcccacag |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6629560 |
ttttaaacgaatttcttcaattttctactcccacag |
6629525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University