View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_high_20 (Length: 228)
Name: NF2047_high_20
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 31828144 - 31828355
Alignment:
| Q |
1 |
ttatggagcatttggaaggcgagaaacgctnnnnnnnntcaggacaaaaaggtctcaactgataagattgtagatcaagtcggattactctcttggaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31828144 |
ttatggagcatttggaaggcgagaaacgctaaaaaaattcaggacaaaaaggtctcgactgataagattgtagatcaagtcagattactctcttggaact |
31828243 |
T |
|
| Q |
101 |
ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttgcacgcttaggtgtcatgggagaagcaaaatcaggaacttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828244 |
ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttgcactcttaggtgtcatgggagaagcaaaatcaggaactta |
31828343 |
T |
|
| Q |
201 |
aggaaggaatga |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31828344 |
aggaaggaatga |
31828355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University