View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_high_22 (Length: 211)
Name: NF2047_high_22
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 32 - 194
Target Start/End: Complemental strand, 31647704 - 31647539
Alignment:
| Q |
32 |
gttaacattctccttattttaaatgatagcgataaggattttatatacattgataaacaatgtatcgagaaacctt---ttaaaagttaactatccaaat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31647704 |
gttaacattctccttattttaaatgatagcgataaggattttatgtacattgataaacaatgtatcgagaaaccttcttttaaaagttaactatccaaat |
31647605 |
T |
 |
| Q |
129 |
actacatcatgcattccatactactcgatgtggaacttgaacatcccataatactcaagtaactat |
194 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31647604 |
actacatcatacattccatactactcgacgtggaacttgaacaccccataatactcaagtaactat |
31647539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 139 - 188
Target Start/End: Original strand, 14658755 - 14658804
Alignment:
| Q |
139 |
gcattccatactactcgatgtggaacttgaacatcccataatactcaagt |
188 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
14658755 |
gcatcccatactactcgatgtggaacttcgacaccccataatacccaagt |
14658804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University