View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_low_11 (Length: 294)
Name: NF2047_low_11
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_low_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 105 - 294
Target Start/End: Original strand, 19504194 - 19504383
Alignment:
| Q |
105 |
ttcttatcatattgacatgatcttccagagattcttatcatattgaccaaaatggagactccttgtattacttatctggtttgttgtagaatccaaaggt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19504194 |
ttcttatcatattgacatgatcttccagagattcttatcatattgactaaaatggagactccttgtattacttatctggtttgttgtggaatccaaaggt |
19504293 |
T |
 |
| Q |
205 |
gactagtttagannnnnnngaacataagacatgtcaatgaaattactaatgtttggtaagaaactaggaacctccatgaacatacaattt |
294 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19504294 |
gactagtttagatttttttgaacataagacatgtcaatgaaattactaatgtttggttagaaactaggaacctccatgaacatacaattt |
19504383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University