View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_low_17 (Length: 250)
Name: NF2047_low_17
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 39893498 - 39893266
Alignment:
| Q |
1 |
catgcatgtaaaccactttctccaattcatcacccagtttctcatccattaactcctctattccaaattcttttctccagagaattgtgttcttgatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39893498 |
catgcatgtaaaccactttctccaattcatcacccagtttctcatccattaactcctctattccaaattcttttctccagagaattgtgttcttgatcat |
39893399 |
T |
|
| Q |
101 |
tgtgaaagcctctttgaccttaaaatctcttgcacgcagaaatttcaacagaattacgtcacttctttcgtcagcaaggagtggtatcccataaatggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39893398 |
tgtgaaagcctctttgaccttaaaatctcttgcacgcagaaatttcaacagaattacgtcacttgtttcgtcagcaaggagtggtatcccataaatggat |
39893299 |
T |
|
| Q |
201 |
acttgttcaggtggtaatggcaacgacgcttca |
233 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39893298 |
acttgttcaggtggtaatggcaatgacgcttca |
39893266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 69 - 190
Target Start/End: Complemental strand, 44641962 - 44641841
Alignment:
| Q |
69 |
tcttttctccagagaattgtgttcttgatcattgtgaaagcctctttgaccttaaaatctcttgcacgcagaaatttcaacagaattacgtcacttcttt |
168 |
Q |
| |
|
||||||||||| | || |||||||||||||||||||| || ||||| || || || ||||| || || ||||| ||||||||||| ||||| |||| | |
|
|
| T |
44641962 |
tcttttctccaacggatagtgttcttgatcattgtgaatgcttctttcactttgaagtctctggctcggagaaacttcaacagaatcacgtcggttctat |
44641863 |
T |
|
| Q |
169 |
cgtcagcaaggagtggtatccc |
190 |
Q |
| |
|
|||| || |||||||||||||| |
|
|
| T |
44641862 |
cgtctgcgaggagtggtatccc |
44641841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University