View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_low_18 (Length: 250)
Name: NF2047_low_18
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 97 - 238
Target Start/End: Original strand, 11928529 - 11928670
Alignment:
| Q |
97 |
tttaacaaatcttgtcttgagaggacaatttcttcgttttggctcgttgcctcacttcttgcaaacaatcaggaaaattattccaaacttaagagagttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
11928529 |
tttaacaaatcttgtcttgagaggacaatttcttcgttttggctcgttgcctcacttcctgcaaacaatcagtaaaattactccaaacttatgagagttg |
11928628 |
T |
|
| Q |
197 |
aggttaattgattttggtcttatagataatgatgtcgcgtct |
238 |
Q |
| |
|
|| || || | ||||||||| |||||||||||||||||||| |
|
|
| T |
11928629 |
agattggttcaatttggtcttctagataatgatgtcgcgtct |
11928670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 11852666 - 11852585
Alignment:
| Q |
157 |
gcaaacaatcaggaaaattattccaaacttaagagagttgaggttaattgattttggtcttatagataatgatgtcgcgtct |
238 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
11852666 |
gcaaacaatcatgaagtttattccaaacttaagagagttgaggttagttgattttggtcttatagatactgatgtcgtgtct |
11852585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 11833401 - 11833321
Alignment:
| Q |
158 |
caaacaatcaggaaaattattccaaacttaagagagttgaggttaattgattttggtcttatagataatgatgtcgcgtct |
238 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
11833401 |
caaacaatcatgaagtttattccaaacttaagagagttgaggttagttgattttggtcttatagatactgatgtcgtgtct |
11833321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 154 - 238
Target Start/End: Original strand, 11962876 - 11962960
Alignment:
| Q |
154 |
cttgcaaacaatcaggaaaattattccaaacttaagagagttgaggttaattgattttggtcttatagataatgatgtcgcgtct |
238 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
11962876 |
cttgcaaacaatcatgaagttttttccaaacttaagagagttgaggttagttgaatttggtctgatagataatgatgtcgcgtct |
11962960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 11928468 - 11928529
Alignment:
| Q |
1 |
tcatgttgggaatcttccatttttgcaaactctgaaacttgatggaaatttcgatctcacat |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
11928468 |
tcatgttgggaatcttccatttttgcaaactctgaaactcgatggaaattttgatctcacat |
11928529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University