View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_low_24 (Length: 231)
Name: NF2047_low_24
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 41653731 - 41653893
Alignment:
| Q |
8 |
gagtgagatgaagaggagtgttgaaatgagcttcatttcctccttca----------atattgttaattggttttatctaatagtgtggaggctatgact |
97 |
Q |
| |
|
|||| ||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41653731 |
gagtaagaagaagaggagagttgaaatgagcttcatttcctccttcaattcttttcaatattgttaattggttttatctaatagtttggaggctatgact |
41653830 |
T |
 |
| Q |
98 |
tatgagttcatgaagttgatatttataagcggttgtgcaccaaaagcataaactatgttgcaa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653831 |
tatgagttcatgaagttgatatttataagcggttgtgcaccaaaagcataaactatgttgcaa |
41653893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 152 - 215
Target Start/End: Original strand, 41654078 - 41654141
Alignment:
| Q |
152 |
atgttgcaattaattaaattttgttggattgcctttcttttttaggtctatagttggattttgt |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41654078 |
atgttgcaattaattaagttttgttggattgcctttcttttttaggtctatagttggattttgt |
41654141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University