View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_low_5 (Length: 394)
Name: NF2047_low_5
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 385
Target Start/End: Original strand, 2310683 - 2311059
Alignment:
| Q |
19 |
tcaattacttgcgatcaatgtttatttatttgaaaatttaaaccaccaagaagtagctttgcatatacgtttttgcatatctgtaattggcaggcgaaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||| |
|
|
| T |
2310683 |
tcaattacttgcgatcaatgtttatttatttgaaaatttaaaccaccaagaagtagctttgcatatacgtttttgcatatctgtaattgccagggggaca |
2310782 |
T |
|
| Q |
119 |
tagaatagaagttttataaattttatcttacttttgcagttggcgaggatgaagagaagctgtgatctgaagctgtttgc----------ttgcatttca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
2310783 |
tagaatagaagttttataaattttatcttacttttgcagatgaggagggtgaagagaagctgtgatctgaagctggttgctactaccatgttgcatttca |
2310882 |
T |
|
| Q |
209 |
tattttatcatttttggaattctgttttattaattttgaatttaactacctagcagatgccccacatatgttggggaataaaaaacaccttgatgttgtg |
308 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2310883 |
tattttatcatttttgaaattctgttttattaa-tttgaatttaactacctagcagatgccccacatttgttggggaataaaaaacaccttgatgttgtg |
2310981 |
T |
|
| Q |
309 |
tgaccatctatttgaatctgtttgcttaataatttgatttac-tttttcggttcaacaatatctatctacagtattat |
385 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
2310982 |
tgaccatctatttgaatctatttgcttgataatttgatttacttttttcggttcaacaatatttgtctacagtattat |
2311059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University