View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2047_low_9 (Length: 307)
Name: NF2047_low_9
Description: NF2047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2047_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 3839105 - 3838832
Alignment:
| Q |
19 |
agcaaaacacccatgacagtgttaattggattcttaaccagtgcaccatcagtgttaaccttgagccagtgaaaattggggggattccaaatcacttctt |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3839105 |
agcaaaacacccatggcagtgttaattggattcttaaccagtgcaccatcagtgttaaccttgagccagtgaaaattggggggattccaaatcacttctt |
3839006 |
T |
 |
| Q |
119 |
tttatcacaggagcccttggagggtgaatgtttatgttgaaggctttgaggaaaacaaattcagtcatattaattctagagcacagcttggtgttattac |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3839005 |
tt-atcacaggagcccttggagggtgaatgtttatgttgaaggctttgaggaaaacaaattcagtcatattaattctagagcacagcttggtgttattac |
3838907 |
T |
 |
| Q |
219 |
ctgagatggaagtataggaaataatggaattgatagcagacctccagtgaatttgcttgtcttgaaatctagctt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3838906 |
ctgagatggaagtataggaaataatggaattgatagcagacctccagtgaatttgcttgtcttgaaatctagctt |
3838832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University