View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20480_high_11 (Length: 303)
Name: NF20480_high_11
Description: NF20480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20480_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 22 - 303
Target Start/End: Complemental strand, 3433898 - 3433617
Alignment:
| Q |
22 |
agaagtctcgcattaaattcctctcgagcaaaatttttatattgaattagaaaatgaaacatataagcaagagaaaccataaccctaatgctttaggatt |
121 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
3433898 |
agaagtctcgtattgaattcctctcgagcaaaattttcacattgaattagaaaatgaaacatataagcaagagaaaccataaccctgatgctttagggtt |
3433799 |
T |
 |
| Q |
122 |
ttggatggagatgtgatcatgtctctctgtcacgcacatgtgtgattgcttttaatcaaatttgaatgattctctggactccctttacaatccaactctt |
221 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
3433798 |
ttgaatggagatgtgatcatgtctctctgtcactcacatgtgtgattgcttttaatcaaatatgaatgattctccggactccctttacaatccaacactt |
3433699 |
T |
 |
| Q |
222 |
attgctaaaattagcgactaattgtttatcaacatttcacaaattggtctgcaaatcggtcataaatcttacttggttgatc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
3433698 |
attgctaaaattagcgactaattgtttaccaacgtttcacaaattggtctccaaatcggtcacaaatcttacttggttgatc |
3433617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University