View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20480_high_14 (Length: 238)
Name: NF20480_high_14
Description: NF20480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20480_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 118 - 222
Target Start/End: Complemental strand, 13317633 - 13317532
Alignment:
| Q |
118 |
cttgattgtcttgaataatcttcaaggaaagaagactctatgtgacttttgcttctttctatgatgtttgagaaagttctcaatctccggtattggctca |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13317633 |
cttgattgtcttgaat---cttcaaggaaagaagactctatgtgacttttgcttctttctatgatgtttgagaaagttctcaatctccggtattggctca |
13317537 |
T |
 |
| Q |
218 |
ctaat |
222 |
Q |
| |
|
||||| |
|
|
| T |
13317536 |
ctaat |
13317532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University