View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20480_high_14 (Length: 238)

Name: NF20480_high_14
Description: NF20480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20480_high_14
NF20480_high_14
[»] chr8 (1 HSPs)
chr8 (118-222)||(13317532-13317633)


Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 118 - 222
Target Start/End: Complemental strand, 13317633 - 13317532
Alignment:
118 cttgattgtcttgaataatcttcaaggaaagaagactctatgtgacttttgcttctttctatgatgtttgagaaagttctcaatctccggtattggctca 217  Q
    ||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13317633 cttgattgtcttgaat---cttcaaggaaagaagactctatgtgacttttgcttctttctatgatgtttgagaaagttctcaatctccggtattggctca 13317537  T
218 ctaat 222  Q
    |||||    
13317536 ctaat 13317532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University