View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20480_low_12 (Length: 347)
Name: NF20480_low_12
Description: NF20480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20480_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 18 - 341
Target Start/End: Original strand, 34166910 - 34167233
Alignment:
| Q |
18 |
agacgaaaatttcgacctaaaacacgaacggaaagggattttatccatggcgaattctggtccgaacaccaatgggagtcagttttttattacgacgacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34166910 |
agacgaaaatttcgacctaaaacacgaacggaaagggattttatccatggcgaattctggtccgaacaccaatgggagtcagttttttattacgacgacg |
34167009 |
T |
|
| Q |
118 |
aggacgccacatttggatgggaagcatgtggtgtttgggaaggttgtgaaagggattggagttgttaggtctgttgagcttggtccggtcggggagaatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167010 |
aggacgccacatttggatgggaagcatgtggtgtttgggaaggttgtgaaagggattggagttgttaggtctgttgagcttggtccggtcggggagaatg |
34167109 |
T |
|
| Q |
218 |
atcggccggagcaggatgttgtgattgctgattgtggggagattgctgaaggggaggatgaaggggttattaacttttttaaagatggtgatacttttgc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34167110 |
atcggccggagcaggatgttgtgattgctgattgtggggagattgctgaaggggaggatgaaggggttattaacttttttaaagatggtgatacttttgc |
34167209 |
T |
|
| Q |
318 |
tgattggcctgtcgatcttgatac |
341 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
34167210 |
tgattggcctgttgatcttgatac |
34167233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 63 - 104
Target Start/End: Complemental strand, 52934817 - 52934776
Alignment:
| Q |
63 |
catggcgaattctggtccgaacaccaatgggagtcagttttt |
104 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
52934817 |
catggcaaatgctggtcccaacaccaatgggagtcagttttt |
52934776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 63 - 104
Target Start/End: Complemental strand, 52942452 - 52942411
Alignment:
| Q |
63 |
catggcgaattctggtccgaacaccaatgggagtcagttttt |
104 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
52942452 |
catggcaaatgctggtcccaacaccaatgggagtcagttttt |
52942411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University