View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20480_low_6 (Length: 474)

Name: NF20480_low_6
Description: NF20480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20480_low_6
NF20480_low_6
[»] chr4 (2 HSPs)
chr4 (299-462)||(32183027-32183190)
chr4 (1-77)||(1611240-1611316)
[»] chr6 (3 HSPs)
chr6 (1-119)||(15858142-15858260)
chr6 (118-202)||(15858706-15858791)
chr6 (365-462)||(15858910-15859008)
[»] scaffold0272 (1 HSPs)
scaffold0272 (1-116)||(2181-2296)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 299 - 462
Target Start/End: Original strand, 32183027 - 32183190
Alignment:
299 ggatggtagtataatttctgttggtttttatgcctggtggaggggtgcggcctgcagtttggttgacagcagtgggtgttggttgtgggttgttgttcca 398  Q
    ||||||||| | | ||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||    
32183027 ggatggtagcagattttttgttggtttttatgcctggtggaggggtgcggcatgcagtttggtagacagcagtgggtgctggttgtgggttgttgttcca 32183126  T
399 gggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggtgaggcagggatattcttg 462  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
32183127 gggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggcgaggcagggatattcttg 32183190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 1611240 - 1611316
Alignment:
1 ttggaaaagtccggcaccgtctaaagtagtggcattctcctggaagcttcttcatgatagaataccctcaaaagtga 77  Q
    ||||||||||||||||||||| ||||| ||||| ||||| ||||||||| |||||||||||||||| ||||||||||    
1611240 ttggaaaagtccggcaccgtccaaagtggtggccttctcttggaagctttttcatgatagaataccgtcaaaagtga 1611316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 83; Significance: 4e-39; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 15858142 - 15858260
Alignment:
1 ttggaaaagtccggcaccgtctaaagtagtggcattctcctggaagcttcttcatgatagaataccctcaaaagtgaccttggctgttagacatgtgtta 100  Q
    ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||| || |||||| |||||||| ||| ||    
15858142 ttggaaaagtccggcaccgtctaaagttgtggcattctcttggaagcttcttcatgatagaataccctctaaagcgaacttggcggttagacaggtgcta 15858241  T
101 cttccggaggcttctcaag 119  Q
    | |||||||||||||||||    
15858242 cctccggaggcttctcaag 15858260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 118 - 202
Target Start/End: Original strand, 15858706 - 15858791
Alignment:
118 agttgttcctgc-tgatgtgcacggttctgtttttgctagcatctgtttttgctgttttgcagttggctgtttgtgcggtctgttc 202  Q
    |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
15858706 agttgttcctgcatgatgtgcacggttccgtttttgctagcatctgtttttgctgttttgcagctggctgtttgtgcggtctgttc 15858791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 365 - 462
Target Start/End: Original strand, 15858910 - 15859008
Alignment:
365 cagcagtgggtgttggttgtgggttgtt-gttccagggcctgttttggtggcttgtggtgaggctgagcgttgtttgtggtgaggcagggatattcttg 462  Q
    |||||||||||| ||||| |||| |||| |||  |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
15858910 cagcagtgggtgctggttctggggtgtttgttttagggcctgttttggtggcttgtggtgaggctgcgcgttgtttgtggtaaggcagggatattcttg 15859008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0272 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0272
Description:

Target: scaffold0272; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 2181 - 2296
Alignment:
1 ttggaaaagtccggcaccgtctaaagtagtggcattctcctggaagcttcttcatgatagaataccctcaaaagtgaccttggctgttagacatgtgtta 100  Q
    ||||||||| ||||| ||||| ||||| ||||  || || |||||||| |||||||||||||| || ||||||||||  |||||   |||||||||||||    
2181 ttggaaaagcccggcgccgtccaaagtcgtggtgttttcatggaagctccttcatgatagaattccgtcaaaagtgaatttggcgtatagacatgtgtta 2280  T
101 cttccggaggcttctc 116  Q
    | ||||||||||||||    
2281 cctccggaggcttctc 2296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University