View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20481_low_5 (Length: 267)
Name: NF20481_low_5
Description: NF20481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20481_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 258
Target Start/End: Complemental strand, 32507409 - 32507164
Alignment:
| Q |
15 |
acattgcacatgctttcaatatgaagtgtcggtgtgctgcagtggtatctattgatcataactaattttgaagca--gacatatagtttatcttgatcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32507409 |
acattgcacatgctttcaatatgaagtgtcggtgtgctgcagaggtatctattgatcataactaattttgaagcatagacatatagtttatcttgatcat |
32507310 |
T |
 |
| Q |
113 |
gagaaatgacatcaatactatgctttgcacatctaattcccaaacaaacatcattcttaacacattaacaactaaaatttcaaagannnnnnnnctacaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32507309 |
gagaaatgacatcaatactatgctttgcacatctaattcccaaacaaacatcattcttaacacattaacaactaaaatttcaaagattttttttctacaa |
32507210 |
T |
 |
| Q |
213 |
gatgtaaactatctaaataacaaccaaggaattcattgagaataat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32507209 |
gatgtaaactatctaaataacaaccaaggaattcattgagattaat |
32507164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University