View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20483_high_26 (Length: 207)
Name: NF20483_high_26
Description: NF20483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20483_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 40956137 - 40955962
Alignment:
| Q |
14 |
attattctaatatgttatctcttgcatgtgtgttggtgtatttggtaggtggggatggacaatgcacaagttgaataaaaagtgggtttgttgaaaatta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40956137 |
attattctaatatgttatctcttgcatgtgtgttggtgtgtttggtaggtggggatggacaatgcacaagttgaataaaaagtgggtttgttgaaaatta |
40956038 |
T |
 |
| Q |
114 |
attatggccgtttgattatacttattattgagcgtttatgattttgcagcttggcaccataggattgtgtcttgct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40956037 |
attatggccgtttgattatacttattattgagcgtttatgattttgcagcttggcaccataggattgtgtcttgct |
40955962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 90 - 170
Target Start/End: Complemental strand, 40942737 - 40942656
Alignment:
| Q |
90 |
aaaaagtgggtttgttgaaaattaattatggccgtttgattat-acttattattgagcgtttatgattttgcagcttggcac |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||| || ||||||| ||||| | |||||| |
|
|
| T |
40942737 |
aaaaagtgggtttgttgaaaattaattatggccgtttgattatctcttactattgaacggttatgatcttgcaacgtggcac |
40942656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 161
Target Start/End: Complemental strand, 40969830 - 40969766
Alignment:
| Q |
98 |
ggtttgttgaaaattaattatggccgtttgattat-acttattattgagcgtttatgattttgca |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| ||||| || ||||||| ||||| |
|
|
| T |
40969830 |
ggtttgttgaaaattaattatgagcgtttgattatcacttaccattgaccggttatgatattgca |
40969766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University