View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20483_low_16 (Length: 282)
Name: NF20483_low_16
Description: NF20483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20483_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 18 - 119
Target Start/End: Original strand, 31699986 - 31700087
Alignment:
| Q |
18 |
gttgtaaccgttcgtcccatttccactttcttcgccaccaccggcgctggtcttgctctttacatcgttctcatcttcgtccctttcatcagtgcgttgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699986 |
gttgtaaccgttcgtcccatttccactttctttgccaccaccggcgctggtcttgctctttacatcgttctcatcttcgtccctttcatcagtgcgttgc |
31700085 |
T |
|
| Q |
118 |
cg |
119 |
Q |
| |
|
|| |
|
|
| T |
31700086 |
cg |
31700087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 204 - 280
Target Start/End: Original strand, 31700170 - 31700246
Alignment:
| Q |
204 |
cagcgttgtgtccactttactattattatcagacgcatccgattaattaccttcttcttgcggttttcactctctcg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31700170 |
cagcgttgtgtccactttactattattatcagacgcatccgattaattaccttcttcttgcggttttcactctctcg |
31700246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University