View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20483_low_21 (Length: 241)
Name: NF20483_low_21
Description: NF20483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20483_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 17435367 - 17435140
Alignment:
| Q |
1 |
ttaacgtggatgataatcaaaacgttagacgtataacaagcattaagagttggctttcataggcatgcatataccatgtcagcctccattacaatttgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17435367 |
ttaacgtggatgataatcaaaacgttagacgtataacaagcattaagagttggctttcataggcatgcatataccatgtcagcctccattacaatttgtg |
17435268 |
T |
 |
| Q |
101 |
ctatacaatcgtgacatgagaatacgttattgctttattcaccgacctgatgcaaacgtaagatgcataactagcaagaaatctaaccagcaagaaaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17435267 |
ctatacaatcgtgacatgagaatacgttattgctttattcaccgacctgatgcaaacgtaagatgcataactagcaagaaatctaaccagcaagaaaggt |
17435168 |
T |
 |
| Q |
201 |
gtttcatttgttttcaacatattattct |
228 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
17435167 |
gtttcatttggcctcaacatattattct |
17435140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 63 - 146
Target Start/End: Complemental strand, 17430424 - 17430343
Alignment:
| Q |
63 |
gcatgcatataccatgtcagcctccattacaatttgtgctatacaatcgtgacatgagaatacgttattgctttattcaccgac |
146 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||| |||| | ||| || |||||||||||||||||||||||||| |
|
|
| T |
17430424 |
gcatgcatatat-atgccagcttccattacaatttgtgctatgaaatcataacagga-aatacgttattgctttattcaccgac |
17430343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University