View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20483_low_23 (Length: 234)
Name: NF20483_low_23
Description: NF20483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20483_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 36250232 - 36250453
Alignment:
| Q |
1 |
atcaaaaaatggtatctcaacaaaaagtcaaagacgggtttattgagtggattcttatacaaaaatagtattatcatcattcatcacatggannnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36250232 |
atcaaaaaatggtatctcaacaaaaagtcaaagaggggtttattgagtggattcttatacaaaaatagtattatcatcattcatcacatggagctggctg |
36250331 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnaaacggtaagtagtaatagtaattgataaaattcttcatatactgttgcttctaaacatcttcaattatcatccttagtgtgttcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36250332 |
ctgctgctgctgcaaacggtaagtagtaatagtaattgataaaattcttcatatactgttgcttctaaacatcttcaattatcatccttagtgtgttcta |
36250431 |
T |
|
| Q |
201 |
caatttggtgttagtaataatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36250432 |
caatttggtgttagtaataatt |
36250453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 114 - 221
Target Start/End: Original strand, 36230072 - 36230190
Alignment:
| Q |
114 |
aaacggtaagtagtaatagtaattgataaaattcttcatatactgttgc-------ttctaaacatcttcaattatcatcctta----gtgtgttctaca |
202 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| ||| || |||||||||||||||||| |||||| |||||||| ||| |
|
|
| T |
36230072 |
aaacggtaagtagtaatagtaattcaaaaaattcttcatatactactgcttataatttataaacatcttcaattatcgtccttagtgtgtgtgttccaca |
36230171 |
T |
|
| Q |
203 |
atttggtgttagtaataat |
221 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
36230172 |
atttggtattagtaataat |
36230190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 36229996 - 36230038
Alignment:
| Q |
1 |
atcaaaaaatggtatctcaacaaaaagtcaaagacgggtttat |
43 |
Q |
| |
|
||||||||||| ||| |||||| |||||||||||||||||||| |
|
|
| T |
36229996 |
atcaaaaaatgttatgtcaacacaaagtcaaagacgggtttat |
36230038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University