View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20484_high_20 (Length: 289)
Name: NF20484_high_20
Description: NF20484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20484_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 49244881 - 49245151
Alignment:
| Q |
1 |
aaatcaaagaaacatgttgaaggggtttttaatttgttggttccctgtcgtaataggaatcccaattgctctgttacggttactggttcaagcaatgtgg |
100 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244881 |
aaatcaaagaaacatgttgaaaggggttttaatttgttggttccctgtcgtaataggaatcccaattgctctgttacggttactggttcaagcaatgtgg |
49244980 |
T |
|
| Q |
101 |
ctttctttgggattgaatctgtggctaaacctggtttgattactgttattttgaaggtgttcttgaagaatgaagctgaggttttagctgctaatgtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244981 |
ctttctttgggattgaatctgtggctaaacctgggttgattactgttattttgaaggtgttcttgaagaatgaagctgaggttttagctgctaatgtttc |
49245080 |
T |
|
| Q |
201 |
tgttaatgatgggaatttgatcttggcaatcactgctttggttcaaaatggtgctgttattgagaagatta |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49245081 |
tgttaatgatgggaatttgatcttggcaatcactgctttggttcaaaatggtgctgttattgagaagatta |
49245151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 250
Target Start/End: Original strand, 49059376 - 49059504
Alignment:
| Q |
122 |
tggctaaacctggtttgattactgttattttgaaggtgttcttgaagaatgaagctgaggttttagctgctaatgtttctgttaatgatgggaatttgat |
221 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||| | || || | ||| |||||||| |||||| || ||||| |||||||||||||| |||||||| |
|
|
| T |
49059376 |
tggctagacctggtttggctactgcgattttgaagatatttgtggacaatcaagctgagattttagtggcaaatgtctctgttaatgatggaaatttgat |
49059475 |
T |
|
| Q |
222 |
cttggcaatcactgctttggttcaaaatg |
250 |
Q |
| |
|
||||||||||||||| ||||||||||||| |
|
|
| T |
49059476 |
cttggcaatcactgcattggttcaaaatg |
49059504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University