View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20484_high_29 (Length: 221)
Name: NF20484_high_29
Description: NF20484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20484_high_29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32836678 - 32836904
Alignment:
| Q |
1 |
gtaataatcataatgtgaaatcatgggaaagttttttgtggttattgtggggaagtatagcaatatgaaatgtcctttgcttattccgattatatgcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32836678 |
gtaataatcataatgtgaaatcataggaaagttttttgtggttattgtggggaagtatagcaatatgaaatgtcctttgcttattccgattatatgcaag |
32836777 |
T |
|
| Q |
101 |
aaatgctcagtgtctcagttatcttctttggaagatatctgt------cccaaaaattaggcaccaagtatgctcgtcgtaatattactgcatcatcaca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
32836778 |
aaatgctcagtgtctcagttatcttctttggaagatatctgttgaaaacccaaaaattaggcaccaagtatgctcgccgtaatattaccgcatcatcaca |
32836877 |
T |
|
| Q |
195 |
aacaatattatttaggcaaatgctaca |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32836878 |
aacaatattatttaggcaaatgctaca |
32836904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University