View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20484_low_13 (Length: 401)
Name: NF20484_low_13
Description: NF20484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20484_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 122 - 392
Target Start/End: Complemental strand, 35451919 - 35451649
Alignment:
| Q |
122 |
gaaggatactttcatcgaatcttatttatacactttaatttatttgaatgaatttgttttatatatgtatatcgttagctgtgttttacagtgttctttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451919 |
gaaggatactttcatcgaatcttatttatacactttaatttatttgaatgaatttgttttatatatgtatatcgttagctgtgttttacagtgttctttt |
35451820 |
T |
 |
| Q |
222 |
caatattcatcggtattctttaggattgatttcatgttttattcatgtcatcagattcaagcgatatggcaagaaaatccgtcaagaatgttacgtacaa |
321 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451819 |
ca-tattcatcggtattctttatgattgatttcatgttttattcatgtcatcagtttcaagcgatatggcaagaaaatccgtcaagaatgttacgtacaa |
35451721 |
T |
 |
| Q |
322 |
agatattgagcaggtaattaatttgtctctctttaatgttttgaatatgtggttatcgtt-tttgttcatct |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35451720 |
agatattgagcaggtaattaatttgtctctttttaatgttttgaatatgtggttatcgttctttgttcatct |
35451649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 13 - 82
Target Start/End: Complemental strand, 35452028 - 35451959
Alignment:
| Q |
13 |
tcatcaaatctcactcatgaatgcagctaaatatttgaactaatatgatcatagggttcttgattattac |
82 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35452028 |
tcatcgaatctcactcatgaatgcagctaaatatttgaactaatatgatcatagggttcttgattattac |
35451959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University