View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20484_low_27 (Length: 263)
Name: NF20484_low_27
Description: NF20484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20484_low_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 25 - 263
Target Start/End: Original strand, 33184898 - 33185140
Alignment:
| Q |
25 |
tgtttgaaattttttatcgttgattgtattcatatttggcttaaaaaatcagtgactatagactata----tataaaatgataaaagagtgggcagtatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33184898 |
tgtttgaaattttttatcgttgattgtattcatatttggcttaaaaaatcagtgactatagactatatatatataaaatgataaaagagtgggcagtatt |
33184997 |
T |
 |
| Q |
121 |
gttccaacacatatattctacatgcagccccctctgtcctcctaaaaatgtgcttgattgttcatttgataattaaacgcaaattaagcaacgtaacaat |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33184998 |
gttccaacacatatattctacatgtagccccctctgtcctcctaaaaatgtgcttgattgttcatttgataattaaacgcaaattaagcaacgtaacaat |
33185097 |
T |
 |
| Q |
221 |
gcttcattatatcttcctataaagctaaatgaaatttaactat |
263 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
33185098 |
gcttcattatattttcctataaaactaaatgaaatttaactat |
33185140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University