View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20485_high_20 (Length: 227)
Name: NF20485_high_20
Description: NF20485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20485_high_20 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 103 - 227
Target Start/End: Original strand, 7646166 - 7646293
Alignment:
| Q |
103 |
atatttaattttgttt-gtcctctaagttttcattgttaatttatttgtcttagtaatgnnnnnnn--tgatcatatgaatctaaattggctccttggat |
199 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| |
|
|
| T |
7646166 |
atatttaatttttttttgtcctctaagttttcattgttaatttatttgtcttagtaatgaaaaaaaaatgaacatatgaatctaaattggctccttcgat |
7646265 |
T |
 |
| Q |
200 |
taaaaataacacatcaattaatttattt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7646266 |
taaaaataacacatcaattaatttattt |
7646293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University