View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20485_high_21 (Length: 215)
Name: NF20485_high_21
Description: NF20485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20485_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 2789035 - 2789221
Alignment:
| Q |
11 |
gtagcataggtagatacttgatannnnnnnctttgactcaagttgaaaaaattattcgctgttgatattcttgtcattaatttaccatggattattgggt |
110 |
Q |
| |
|
|||| |||||||||||||||||| |||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2789035 |
gtagtataggtagatacttgatatttttttctttgaattaagttgaaaaaattattcactgttgatattcttgtcattaatttaccatggattattgggt |
2789134 |
T |
|
| Q |
111 |
tttgtaacagtcttgattttactattaagaaaattacatagttatattatactttacttttcaattgttggaacacagctaagaatt |
197 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2789135 |
tttgtaacagtcttgattttagtattaagaaaattacatagttatattatactttacttttcaattgttggaacacaactaagaatt |
2789221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University