View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20485_low_11 (Length: 295)
Name: NF20485_low_11
Description: NF20485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20485_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 110 - 277
Target Start/End: Original strand, 32336650 - 32336812
Alignment:
| Q |
110 |
tgtcatccattcatggcatttatttgtgaagatcaaataaaatnnnnnnncacaatagcaattaacaaacttaatttctcccattgaattgtaaaacgtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32336650 |
tgtcatccattcatggcatttatttgtgaagatcaaataaaa-----aaacacaatagcaattaacaaacttaatttctcccattgaattgtaaaacgtg |
32336744 |
T |
|
| Q |
210 |
tatttgtcaaagaaacaatagcaatggatcaaacgtggcatccatattaccaactaccaattactagc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32336745 |
tatttgtcaaagaaacaatagcaatggatcaaacgtggcatccatattaccaactaccaattactagc |
32336812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 32336506 - 32336617
Alignment:
| Q |
1 |
tctccctccctaaccccacataaatcctttcaccaaatagacgcattaatacctctctcggcccccttctaacccatatttttagcttttgaattatgac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32336506 |
tctccctccctaacccggcataaatcctttcatcaaatagatgcattaatacctccctcggcccccttctaacccatatttttagcttttgaattatgac |
32336605 |
T |
|
| Q |
101 |
atatgggattgt |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32336606 |
atatgggattgt |
32336617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University