View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20485_low_12 (Length: 290)
Name: NF20485_low_12
Description: NF20485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20485_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 52385795 - 52385535
Alignment:
| Q |
16 |
gttttgtcatctgtcggaagctgtgttgctgttgatgtgctcaccgtggctactttattagtaagatttgttacatcatccttcatagtactattttgca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385795 |
gttttgtcatctgtcggaagctgtgttgctgttgatgtgctcaccttggctactttattagtaagatttgttacatcatccttcatagtactattttgca |
52385696 |
T |
 |
| Q |
116 |
tggtaactggatctgcaactaattggatgnnnnnnncactagggtttgatgtggcaatggcaaacatcatgtttctctctagagttgtttgaggttcaga |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385695 |
tggtaattggatctgcaactaattggatgtttttttcactagggtttgatgtggcaatggcaaacatcatgtttctctctagagttgtttgaggttcaga |
52385596 |
T |
 |
| Q |
216 |
aattgaggtaggaggaggctgtggtggggaataggccaattgtgaaggaaattttgatctt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385595 |
aattgaggtaggaggaggctgtggtggggaataggccaattgtgaaggaaattttgatctt |
52385535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University