View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20485_low_17 (Length: 251)
Name: NF20485_low_17
Description: NF20485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20485_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 19397392 - 19397611
Alignment:
| Q |
17 |
aatataagaaaatacaatgttgtggaaaacccacacataacccactctatagtctaaaatttgatttttctaacttaattactcatatgatgtcatctaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19397392 |
aatataagaaaatacaatgttgtggaaaacccacacataacccactctatagtctaaaatttgatttttctaacttaattactcatatgatgtcatctaa |
19397491 |
T |
 |
| Q |
117 |
ttatcccagttctattagttgttttattttgcagaccatatttgatgtcatctaagtacctcagttatatgagttggtttaattgcacttcaaatttttc |
216 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19397492 |
ctatcccagttctattgattgttttattttgcacaacatatttgatgtcatctaagtacctcagttatatgagttggtttaattgcacttcaaatttttc |
19397591 |
T |
 |
| Q |
217 |
tgtccagttccatcctaact |
236 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
19397592 |
tgtccggttccatcctaact |
19397611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University