View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20485_low_19 (Length: 248)
Name: NF20485_low_19
Description: NF20485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20485_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 54974076 - 54973835
Alignment:
| Q |
1 |
aaaaaggtccttcattaacaactctaattcccattctgtccctcctccggtgaccggaaaaaatggcagtctctgccagtggtcagttaatgctatcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54974076 |
aaaaaggtccttcattaacaactctaattcccattctgtccctcctccggtgaccggaaaaaatggcagtctctgccagtggtcagttaatgctatcctc |
54973977 |
T |
 |
| Q |
101 |
tacagttcagctacgtgagccaggaatggtgagcagtaggaactt---------gaagttttgtaatggagaaatgatgggacgaaagattgagcttcat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54973976 |
tacagttcagctacgtgagccaggaatggtgagcagtaggaacttgaaggttgtgaagttttgtaatggagaaatgatgggacgaaagattgagcttcat |
54973877 |
T |
 |
| Q |
192 |
gctgctaccaatggttgcactaagaatgtttataggaaaaat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54973876 |
gctgctaccaatggttgcactaagaatgtttataggaaaaat |
54973835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University