View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20485_low_9 (Length: 307)
Name: NF20485_low_9
Description: NF20485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20485_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 20 - 289
Target Start/End: Original strand, 6311994 - 6312263
Alignment:
| Q |
20 |
tgatcatgttgagtttattgtctttctagttcctacccaccgtgtattttttcgtgtgaactaagtaggtatcatatactcacaattgcaaagaataatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6311994 |
tgatcatgttgagtttattgtctttctagttcctacccaccgtgtattttttcgtgtgaactaagtaggtatcatatacgcacaattgcaaagaataatc |
6312093 |
T |
 |
| Q |
120 |
tttcaagttgcatatgattataatagatggtaaaactgtccttcaaaaaatttatttaatgatgttgcattccatgatttaagatattcggtgattcttt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6312094 |
tttcaagttgcatatgattataatagatggtaaaactgtccttcaaaaaatttatttaatgatgttgcatttcatgatttaagatattcggtgattcttt |
6312193 |
T |
 |
| Q |
220 |
ccttttcatattagtaacatattttactaaaaatacaagggaatctagttacccaagagtaacatattct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6312194 |
ccttttcatattagtaacatattttactaaaaatacaagggaatctagttacccaagagtaacatattct |
6312263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University