View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20486_high_23 (Length: 283)
Name: NF20486_high_23
Description: NF20486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20486_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 6491574 - 6491368
Alignment:
| Q |
1 |
tccttattattaaagcacggtttgtatnnnnnnnnntcttagttggtgctgagaaaatgaacttctttcacaagggttctagtattatccaacaatgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
6491574 |
tccttattattaaagcacggtttgtataaaaaaaa-tcttagttggtgctgagaaaatgaacttatttcacaagggttctagtattatccaacaatgtat |
6491476 |
T |
|
| Q |
101 |
tcaccgtcgtcgtcgtccctaatttgagcat--------tccatatgaagtgaacaaaatgatataatgataaatttcaagcaaattggtataaatttgt |
192 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491475 |
tcaccgtcgt---cgtccctaatttgagcatattgatcctccatatgaagtgaacaaaatgatataatgataaatttcaagcaaattggtataaatttgt |
6491379 |
T |
|
| Q |
193 |
tcgattctact |
203 |
Q |
| |
|
||||||||||| |
|
|
| T |
6491378 |
tcgattctact |
6491368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 211 - 283
Target Start/End: Complemental strand, 6491321 - 6491249
Alignment:
| Q |
211 |
gaatggtctaaagatccgcatggccaaatctggtaatagataaacaactggaatgtttggaaaaacccaacat |
283 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491321 |
gaatggtctaaagatccgcatggcaaaatctggtaatagataaacaactggaatgtttggaaaaacccaacat |
6491249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University