View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20486_high_29 (Length: 276)
Name: NF20486_high_29
Description: NF20486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20486_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 4 - 261
Target Start/End: Complemental strand, 33470420 - 33470163
Alignment:
| Q |
4 |
attctgggacaaaaagagcagtgccgaggatttgaagaaggtttctgctgatctaagagcatccatctggaaacagatgtctgatgttgggatcaagtat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33470420 |
attctgggacaaaaagagcagtgccgaggatttgaagaaggtttctgctgatctaagagcatccatctggaaacagatgtctgatgttgggatcaagtat |
33470321 |
T |
|
| Q |
104 |
atcccaagcaacacttttacttactatgatcatgtacttgatactaccgccactctcggggccgttccacccaggtatggatggactggtggtgagattg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33470320 |
atcccaagcaacacttttacttactatgatcatgtacttgatactaccgccactctcggggccgttccacccaggtatggatggactggtggtgagattg |
33470221 |
T |
|
| Q |
204 |
gattcgatacttacttttcaatggctagaggtaatgccaccgtccctgctatggagat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33470220 |
gattcgatacttacttttcaatggctagaggtaatgccaccgtccctgctatggagat |
33470163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 82; Significance: 9e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 9832237 - 9832470
Alignment:
| Q |
4 |
attctgggacaaaaagagcagtgccgaggatttgaagaaggtttctgctgatctaagagcatccatctggaaacagatgtctgatgttgggatcaagtat |
103 |
Q |
| |
|
||||||||| || |||||||| |||||||||||| ||||||| ||||||| || || ||||| ||||||||||||||||| || |||||||||||| |
|
|
| T |
9832237 |
attctgggataagaagagcagcgccgaggatttggagaaggtggctgctgacctcagggcatctatctggaaacagatgtccagtgccgggatcaagtat |
9832336 |
T |
|
| Q |
104 |
atcccaagcaacacttttacttactatgatcatgtacttgatactaccgccactctcggggccgttccacccaggtatggatggactggtggtgagattg |
203 |
Q |
| |
|
||||| ||||||||||| | ||||||||||| || || |||| ||||||| |||| || ||||| || || || ||||||||||| |||||||||| |
|
|
| T |
9832337 |
atccctagcaacactttcgcatactatgatcaggtgctcaataccaccgccatggtcggtgctgttcccccaagatacggatggactggcggtgagattg |
9832436 |
T |
|
| Q |
204 |
gattcgatacttacttttcaatggctagaggtaa |
237 |
Q |
| |
|
|||||||||| ||||| || ||||| |||||||| |
|
|
| T |
9832437 |
gattcgatacctacttctccatggccagaggtaa |
9832470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University