View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20486_high_33 (Length: 241)
Name: NF20486_high_33
Description: NF20486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20486_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 33178255 - 33178463
Alignment:
| Q |
19 |
taatccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctttatcttaatatttcatttccatatgctagttaaaagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33178255 |
taatccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctttatcttaatatttcatttccatatgctagctaaaagt |
33178354 |
T |
 |
| Q |
119 |
ttagaaaagtagaaag---nnnnnnnnnngttagggcaaacagtacctaagtacgtatatatattccaagattaagctcttcaaagcgtgctcgatattt |
215 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
33178355 |
ttagaaaagtataaagaaaaaaaaaaaaagttagggcaaacagta-ctaagtacg--tatatatcccaagattaagctcttcaaagcgtactcgatattt |
33178451 |
T |
 |
| Q |
216 |
ttaagtaatatt |
227 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
33178452 |
ttaagttatatt |
33178463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 33155465 - 33155550
Alignment:
| Q |
23 |
ccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctttatcttaatatttcatttccatatgcta |
109 |
Q |
| |
|
|||||||| | ||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
33155465 |
ccccctgccagcttcacttcaccgttgtgtactttgaagaaaatcaattctgaggtc-ttattttaatatttcattttcatatgcta |
33155550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 33290132 - 33290054
Alignment:
| Q |
21 |
atccccctgctaacttcacttcaccgctgtgtactttgaagaaaatcaattctgaggtctttatcttaatatttcattt |
99 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||| |||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
33290132 |
atccccctgctagcttcactccaccgttgtgtattttgaagaaaattaattctgaggtctttattttaatattttattt |
33290054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 33137740 - 33137787
Alignment:
| Q |
19 |
taatccccctgctaacttcacttcaccgctgtgtactttgaagaaaat |
66 |
Q |
| |
|
|||||| || |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
33137740 |
taatccaccagctagcttcacttcaccgctgtgtactttgaagcaaat |
33137787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University