View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20486_high_38 (Length: 227)
Name: NF20486_high_38
Description: NF20486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20486_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 60 - 158
Target Start/End: Complemental strand, 30797684 - 30797586
Alignment:
| Q |
60 |
atgcactgtaaggttaaaaaatggctcattacatttactttaaacatacaaaccctaatcttattagtcattgaccacaaaatctcaatttcttttcac |
158 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30797684 |
atgcactataaggttaaaaaatggctcagtacatttactttaaacatacaaaccctaatcttattagtcattgaccacaaaatctcaatttcttttcac |
30797586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 57
Target Start/End: Complemental strand, 30800401 - 30800346
Alignment:
| Q |
2 |
cactcgttaataagaccatattaaaaagaaaggaaaagatgaatctatgttaggcc |
57 |
Q |
| |
|
|||||||||| |||||| ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
30800401 |
cactcgttaacaagaccctattaaaaatgagggaaaagatgaatctatgttaggcc |
30800346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University