View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20486_high_9 (Length: 411)
Name: NF20486_high_9
Description: NF20486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20486_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 22 - 112
Target Start/End: Complemental strand, 10086932 - 10086842
Alignment:
| Q |
22 |
gtgtatgtatgtcaaatatcaaataccgttaaatattcaaatttatttgaggataggaaacttgttttattatgttccatttccataccta |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10086932 |
gtgtatgtatatcaaatatcaaataccgttaaatattcaaattgatttgaggataggaaacttgttttattatgttccatttccataccta |
10086842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University