View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20486_low_40 (Length: 225)
Name: NF20486_low_40
Description: NF20486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20486_low_40 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 40 - 225
Target Start/End: Original strand, 30797337 - 30797522
Alignment:
| Q |
40 |
tgttagaataatcatttaggaatataagttttattagtaaaaccatgtgatttaaaaattataatgtctttagaggcnnnnnnnaggaagtattttagat |
139 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
30797337 |
tgttagaataatcacttaggaatataagttttattggtaaaaccatgtgatttaaaaattataatgtctttagaggctttttttaagaagtattttagat |
30797436 |
T |
|
| Q |
140 |
ctagtccaaacaaatataaaaatgatggatctacannnnnnncatcgattaatgacgttaacagtcgaaatttttccagatctaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30797437 |
atagtccaaacaaatataaaaatgatggatctgcattcttttcatccattaatgacgttaacagtcgaaatttttccagatctaat |
30797522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University