View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20487_high_17 (Length: 264)
Name: NF20487_high_17
Description: NF20487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20487_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 113 - 249
Target Start/End: Complemental strand, 41885382 - 41885249
Alignment:
| Q |
113 |
agagatagagaaaatgaccttagggcttaggattatggtaaggaattcttcttctggtagagaaggaggaagaagaagaggtgatgtagttgatgccatg |
212 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41885382 |
agagagagagagaatgaccttagggcttaggattatggtaaggaattcttct---ggtagagaaggaggaggaagaagaggtgatgtagttgatgccatg |
41885286 |
T |
|
| Q |
213 |
tcttgcagcaaatggcaacaacctctggtgtagaatg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41885285 |
tcttgcagcaaatggcaacaacctctggtgtagaatg |
41885249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 12 - 123
Target Start/End: Complemental strand, 41885545 - 41885432
Alignment:
| Q |
12 |
aatactcatcactttctcgaaatctttggaagtattgacatc-gtggtggtcatgtgaaaaagagggattgc-tgaagtggatgatgattgacgtagaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41885545 |
aatactcatcactttctcgaaatctttgaaagtattgacatcggtggtggtcatgtgaaaaagagggattgcatgaagtggatgatgattgacgtagaaa |
41885446 |
T |
|
| Q |
110 |
gttagagatagaga |
123 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
41885445 |
gttagagagagaga |
41885432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University