View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20487_high_20 (Length: 205)

Name: NF20487_high_20
Description: NF20487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20487_high_20
NF20487_high_20
[»] chr4 (1 HSPs)
chr4 (102-185)||(5176519-5176602)


Alignment Details
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 102 - 185
Target Start/End: Original strand, 5176519 - 5176602
Alignment:
102 aacaagagattgtgattagttacctggcctatgtttaatttattagtccttactgcatatgacattgtcaaacgtttgattgca 185  Q
    |||||||||||||||||||||||||||||||||| |||||||||  ||| |||| ||||||||||||||||| || ||||||||    
5176519 aacaagagattgtgattagttacctggcctatgtctaatttatttttccgtactacatatgacattgtcaaatgtctgattgca 5176602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University