View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20487_low_14 (Length: 310)
Name: NF20487_low_14
Description: NF20487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20487_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 40690139 - 40689849
Alignment:
| Q |
1 |
agattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatgatcttcatcaggttccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40690139 |
agattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatgatcttcatcaggttccaaa |
40690040 |
T |
|
| Q |
101 |
gccattggtgtcaaagagagtgtagtgttggctgcagatgttcccaccggcgcgcggtgacgcctcatatggccacctagtgcttgaccagatgtgaatt |
200 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40690039 |
gccattgttgtcaaagagagtgtggtgttggctgcagaagttcccaccggtgcacggtggcgcctcatatggccacctagtgcttgaccagatgtgaatt |
40689940 |
T |
|
| Q |
201 |
cagaaccacaaatggaacactcatgaaccttagacttgttgttattgttgcttccaccatgtagatttcccttaccattgttattcaattg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40689939 |
cagaaccacaaatggaacactcatgaaccttagacttgttgttattgttgcttccaccatgtagatttcccttaccattgttattcaattg |
40689849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 34710589 - 34710513
Alignment:
| Q |
165 |
tcatatggccacctagtgcttgaccagatgtgaattcagaaccacaaatggaacactcatgaaccttagacttgttg |
241 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||| ||||||||||||||| ||| ||| |||||| || |||||| |
|
|
| T |
34710589 |
tcatatggccaccaagtgcctggccagatgtgaatttagaaccacaaatggagcacccataaaccttggatttgttg |
34710513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 165 - 231
Target Start/End: Complemental strand, 34714285 - 34714219
Alignment:
| Q |
165 |
tcatatggccacctagtgcttgaccagatgtgaattcagaaccacaaatggaacactcatgaacctt |
231 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||| ||||||||||||||| ||| ||| |||||| |
|
|
| T |
34714285 |
tcatatggccaccaagtgcctggccagatgtgaatttagaaccacaaatggagcacccataaacctt |
34714219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 53
Target Start/End: Complemental strand, 34710740 - 34710689
Alignment:
| Q |
2 |
gattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaag |
53 |
Q |
| |
|
|||||||| ||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
34710740 |
gattctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag |
34710689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 34714433 - 34714363
Alignment:
| Q |
5 |
tctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctagg |
78 |
Q |
| |
|
||||| ||||| |||| || ||||||||||||||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
34714433 |
tctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag---agacattcattttctttctagg |
34714363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 240
Target Start/End: Original strand, 20925729 - 20925806
Alignment:
| Q |
163 |
cctcatatggccacctagtgcttgaccagatgtgaattcagaaccacaaatggaacactcatgaaccttagacttgtt |
240 |
Q |
| |
|
|||||| || ||||| | |||||| || |||||||| || ||||||||||||||||||||||||| ||| | |||||| |
|
|
| T |
20925729 |
cctcatgtgtccacccaatgcttgtccggatgtgaactctgaaccacaaatggaacactcatgaatcttggccttgtt |
20925806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 232
Target Start/End: Complemental strand, 35506246 - 35506177
Alignment:
| Q |
163 |
cctcatatggccacctagtgcttgaccagatgtgaattcagaaccacaaatggaacactcatgaacctta |
232 |
Q |
| |
|
|||||| || ||||| | ||||||||| ||||||||||||| ||||| || |||||| ||||||||||| |
|
|
| T |
35506246 |
cctcatgtgaccacccaatgcttgacctgatgtgaattcagctccacatattgaacacccatgaacctta |
35506177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University