View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20487_low_15 (Length: 287)
Name: NF20487_low_15
Description: NF20487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20487_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 10 - 183
Target Start/End: Complemental strand, 33177041 - 33176867
Alignment:
| Q |
10 |
attattctgcaccaccatgggctcttcacgaattttctcttgcaatttttggtttaaaaatattggatttagttttttctggattcaagatat-ggtttc |
108 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||| |
|
|
| T |
33177041 |
attattcggcaccgccatgggctcttcacgaattttctcttgcaatttttggtttaaaaatattggatttagttgtttctgggttcaagatatgggtttc |
33176942 |
T |
 |
| Q |
109 |
tttcattatgatatacagtttatgcaccactggttccatggtcgacattctgcttgaaccatcaaggagagaata |
183 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33176941 |
tttcattataatatacagtttatgcaccactggttccatggtcgacattctgcttggaccatcaaggagagaata |
33176867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 199 - 270
Target Start/End: Complemental strand, 33176431 - 33176360
Alignment:
| Q |
199 |
aatcctttaagaatacgaaatcgaaacaaaatttaaaaacaagaaacctttcaagtggattaacacatcaac |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33176431 |
aatcctttaagaatacgaaatcgaaacaaaatttaaaaacaaaaaacctttcaagtggattaacacatcaac |
33176360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 204 - 268
Target Start/End: Original strand, 35382314 - 35382377
Alignment:
| Q |
204 |
tttaagaatacgaaatcgaaacaaaatttaaaaacaagaaacctttcaagtggattaacacatca |
268 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
35382314 |
tttaagaatacggaaacgaaacaaagtttaaaatcaag-aacctttcaagtggattaacgcatca |
35382377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 55 - 100
Target Start/End: Complemental strand, 23356753 - 23356708
Alignment:
| Q |
55 |
tttttggtttaaaaatattggatttagttttttctggattcaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
23356753 |
tttttggtttaaaaatattggatttggttgtttctagattcaagat |
23356708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University