View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20487_low_22 (Length: 205)
Name: NF20487_low_22
Description: NF20487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20487_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 102 - 185
Target Start/End: Original strand, 5176519 - 5176602
Alignment:
| Q |
102 |
aacaagagattgtgattagttacctggcctatgtttaatttattagtccttactgcatatgacattgtcaaacgtttgattgca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||| |||| ||||||||||||||||| || |||||||| |
|
|
| T |
5176519 |
aacaagagattgtgattagttacctggcctatgtctaatttatttttccgtactacatatgacattgtcaaatgtctgattgca |
5176602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University