View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20487_low_8 (Length: 353)
Name: NF20487_low_8
Description: NF20487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20487_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 158 - 322
Target Start/End: Complemental strand, 45181195 - 45181037
Alignment:
| Q |
158 |
cttccaaagtcttttgtcccagatatattgaacctgaactctagaagaaaattgtagactcagttgnnnnnnnngaagaagaaggtcttcatctggtata |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45181195 |
cttccaaagtcttttgtcccagatatattgaacctgaactctagaagaaaattgtagactcagttgaaaaaaa-gaagaagaaggtcttcatctggtata |
45181097 |
T |
 |
| Q |
258 |
gacaaccgaagacgaggaggtcagcaacagtttctcaactagactagaggccaatggatttaagt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45181096 |
gacaaccgaagacgaggaggtcagcaacagtttctca-----accagaggccaatggatttaagt |
45181037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 45181343 - 45181290
Alignment:
| Q |
10 |
aaaagaaggatttgtctataggtggtgtgcgtgctaagagggtcatgtaaacaa |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45181343 |
aaaagaaggatttgtctataggtggtgtgcgtgctaagagggtcatgtaaacaa |
45181290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University