View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20488_low_15 (Length: 213)
Name: NF20488_low_15
Description: NF20488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20488_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 34658918 - 34658747
Alignment:
| Q |
20 |
attacaacttctgaaaacttaaccttgagaaggcgatcgatgtctttattgaagacactaaatgggcgcatcttagctgaagagaaagaaattgaaggaa |
119 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34658918 |
attacaacttctgagaccttaaccttgagaaggcgat----gtctttattgaagacactaaatggga-catcttagctgaagagaaagaaattgaaggaa |
34658824 |
T |
 |
| Q |
120 |
tgttgtttgaaatgcccgctt-aagacatggagaaacatcttgagccttcattcgtcaaagctccattaacagtatg |
195 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34658823 |
tgttgtttgaaaagcccgctttaagacatggagaaacatcttgagccttcattcgtcaaagctccattaacagtatg |
34658747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University