View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20488_low_9 (Length: 302)
Name: NF20488_low_9
Description: NF20488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20488_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 30738196 - 30738463
Alignment:
| Q |
19 |
caaacactaaggcgtaaacatctaaacgcttggttatggttctacatagattgaaagctgaaaattcaggactacttatttaaattttttccataactta |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30738196 |
caaacactaaggcgtaaacatctaaatgcttggttatggttctacatagattgaaagctgaaaattcagtactacttatttaaatattttccataactta |
30738295 |
T |
|
| Q |
119 |
ccgaatcagggatttatgaaattcatgaaaataaaaaccggcatgtggaaaattaaagattattcgatcaaatttattattcttgagacgctggtcttga |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30738296 |
ccgaatctgggatttatgaaattcatgaaagtagaaaccggcatgtggaaaattaaagattattcgatcaaatttattattcttgagacgctggtcttga |
30738395 |
T |
|
| Q |
219 |
gccatgttgtgaacatccacattgtgcaagatggtgcagccaagatccttgagttcagtcaagttaat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30738396 |
gccatgttgtgaacatccacattgtgcaagatggtccagccaagatccttgagttcagtcaagttaat |
30738463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 283
Target Start/End: Original strand, 30708290 - 30708352
Alignment:
| Q |
221 |
catgttgtgaacatccacattgtgcaagatggtgcagccaagatccttgagttcagtcaagtt |
283 |
Q |
| |
|
|||||||||||||||||| | ||||| |||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
30708290 |
catgttgtgaacatccacttcgtgcatgatggtgcagccaagaccctcaagttcaatcaagtt |
30708352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University