View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2048_high_2 (Length: 320)
Name: NF2048_high_2
Description: NF2048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2048_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 19 - 170
Target Start/End: Complemental strand, 9522169 - 9522018
Alignment:
| Q |
19 |
aggagacagtggagaatagtctcgttttcattatgccaaaatggacaatcagaagaaacattggcacctctgtatgccaaaacattgaacactagctgct |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9522169 |
aggagacggtggagaatagtctcgttttcattatgccaaaatggacaatcagaagaaacattgacacctctgtatgccaaaacattgaacactagctgct |
9522070 |
T |
 |
| Q |
119 |
accagtaatttccaaatccaactccaagtttcttgaggcatttataatgcaa |
170 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9522069 |
accagtaatttccaaatccaactccaaatttcttgagacatttataatgcaa |
9522018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 9521994 - 9521946
Alignment:
| Q |
195 |
aagaatgatgcaattttacttattaccgatgtgaattggttttcttatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9521994 |
aagaatgatgcaattttacttattaccgatgtgaattggttttcttatt |
9521946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 8963173 - 8963254
Alignment:
| Q |
19 |
aggagacagtggagaatagtctcgttttcattatgccaaaatggacaatcagaagaaacattggcacctctgtatgccaaaa |
100 |
Q |
| |
|
||||||| ||||||||||||||| | ||||||||| ||||||||||||| | || |||||||| || || |||||||||||| |
|
|
| T |
8963173 |
aggagacggtggagaatagtctcatcttcattatgacaaaatggacaataaaaaaaaacattgacatctttgtatgccaaaa |
8963254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 8956183 - 8956121
Alignment:
| Q |
19 |
aggagacagtggagaatagtctcgttttcattatgccaaaatggacaatcagaagaaacattg |
81 |
Q |
| |
|
||||||| ||||||||||||||| | ||||||||| |||||||||||| | || |||||||| |
|
|
| T |
8956183 |
aggagacggtggagaatagtctcatcttcattatgataaaatggacaataaaaaaaaacattg |
8956121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University