View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2048_low_9 (Length: 274)
Name: NF2048_low_9
Description: NF2048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2048_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 43307733 - 43307469
Alignment:
| Q |
1 |
aacttgtgttagccaaccttgtacatcaatttaattgggaattacctggattggaaaccttggacatgtctgaaacatttggtttaaccatgcatagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307733 |
aacttgtgttagccaaccttgtacatcaatttaattgggaattacctggattggaaaccttggacatgtctgaaacatttggtttaaccatgcatagaaa |
43307634 |
T |
|
| Q |
101 |
gactcctcttttggcagttgcaacccttaagaataagtaaaagaagtggtgggatcacaatttggctttttggaaaaatgtttaatatatttggtaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307633 |
gactcctcttttggcagttgcaacccttaagaataagtaaaagaggtggtgggatcacaatttggctttttggaaaaatgtttaatatatttggtaatct |
43307534 |
T |
|
| Q |
201 |
tagggatacatccttttggttgtatttgtggatgaggttttgttgtgttagagttttagtataat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307533 |
tagggatacatccttttggttgtatttgtggatgaggttttgttgtgttagagttttagtataat |
43307469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 3 - 126
Target Start/End: Complemental strand, 43267134 - 43267008
Alignment:
| Q |
3 |
cttgtgttagccaaccttgtacatcaatttaattgggaattacctgg-attg--gaaaccttggacatgtctgaaacatttggtttaaccatgcatagaa |
99 |
Q |
| |
|
|||||||| || |||||||||||||||||||| |||||||||||||| || ||| ||||||||||||||| | ||||| || || ||||||||| |
|
|
| T |
43267134 |
cttgtgttggcaaaccttgtacatcaatttaactgggaattacctggtgctgctgaaggattggacatgtctgaatcgtttggcttcacagtgcatagaa |
43267035 |
T |
|
| Q |
100 |
agactcctcttttggcagttgcaaccc |
126 |
Q |
| |
|
||| ||||||| ||||| ||||||||| |
|
|
| T |
43267034 |
agattcctcttatggcaattgcaaccc |
43267008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 3 - 126
Target Start/End: Complemental strand, 43286935 - 43286809
Alignment:
| Q |
3 |
cttgtgttagccaaccttgtacatcaatttaattgggaattacctgg-attg--gaaaccttggacatgtctgaaacatttggtttaaccatgcatagaa |
99 |
Q |
| |
|
|||||||| || |||||||||||||||||||| |||||||||||||| || ||| ||||||||||||||| | ||||| || || ||||||||| |
|
|
| T |
43286935 |
cttgtgttggcaaaccttgtacatcaatttaactgggaattacctggtgctgctgaaggattggacatgtctgaatcgtttggcttcacagtgcatagaa |
43286836 |
T |
|
| Q |
100 |
agactcctcttttggcagttgcaaccc |
126 |
Q |
| |
|
||| ||||||| ||||| ||||||||| |
|
|
| T |
43286835 |
agattcctcttatggcaattgcaaccc |
43286809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 43274398 - 43274353
Alignment:
| Q |
4 |
ttgtgttagccaaccttgtacatcaatttaattgggaattacctgg |
49 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
43274398 |
ttgtgttagccaatcttatacatcaatttgattgggaattacctgg |
43274353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University