View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20490_low_9 (Length: 230)
Name: NF20490_low_9
Description: NF20490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20490_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 48681361 - 48681160
Alignment:
| Q |
19 |
attatttggcttgcccgcctgttttggaaactataattgaaccatgttgttttcatgtcatgattgtttggaag-atggtctttaacttggtcattcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48681361 |
attatttggcttgcccgcctgttttggaaactataattgaaccatgttgttttcatgtcatgattgtttggaagcatggtctttaacttggtcattcaat |
48681262 |
T |
|
| Q |
118 |
tttaataactttgaagttctttgacagccgaagaggtcgatctctcctatgatgtacaacattgggcaaccttgtccgactctgagaagcacttcatctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
48681261 |
tttaataactttgaagttctttgacagccgaagaggtcgatctctcctatgatgtacaacattgggcaaccttgtctgactctgagaagcacttcatatc |
48681162 |
T |
|
| Q |
218 |
ac |
219 |
Q |
| |
|
|| |
|
|
| T |
48681161 |
ac |
48681160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University